AJP - Endo AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 282: E1380-E1384, 2002; doi:10.1152/ajpendo.00453.2001
0193-1849/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiriyama, Y.
Right arrow Articles by Tokumitsu, Y.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kiriyama, Y.
Right arrow Articles by Tokumitsu, Y.
Vol. 282, Issue 6, E1380-E1384, June 2002

Calcitonin gene expression induced by lipopolysaccharide in the rat pituitary

Yoshimitsu Kiriyama1, Yasuyuki Nomura2, and Yukiko Tokumitsu3

1 Departments of Physiological Chemistry and 2 Pharmacology, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo, 060-0812; and 3 Health Sciences University of Hokkaido, Ishikari-Tobetsu, 061-0293, Japan


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Procalcitonin (PCT), the precursor protein of calcitonin (CT), has been considered recently as a significant indicator of bacterial infection and sepsis. However, the major source of PCT in sepsis remains unclear. The hypothalamic-pituitary-adrenal axis is activated during sepsis. Moreover, immunoreactive CT (iCT) can be detected in the pituitary. Therefore, we examined the effects of lipopolysaccharide (LPS) administration on CT mRNA expression in the pituitary. After administration of LPS, CT mRNA expression in the pituitary was increased significantly. The increase of CT mRNA was associated with significant elevations of the iCT levels in the serum. These results imply that the pituitary is one of the sources of the serum PCT during sepsis.

procalcitonin; sepsis; lipopolysaccharide


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE BACTERIAL ENDOTOXIN, LIPOPOLYSACCHARIDE (LPS), is thought to be a direct cause of endotoxin shock in gram-negative sepsis. LPS induces a number of shock-state abnormalities that are similar to those observed in sepsis, including fever, hypotension, and multiorgan system failure (5, 14). There are ~500,000 septic episodes each year in the United States, and the mortality rate in patients with septic shock ranges from 35 to 65% (11). Although some proinflammatory cytokines such as interleukin (IL)-1beta , IL-6, and tumor necrosis factor (TNF)-alpha have been proposed as indicators of sepsis severity, they are often transiently increased and produced only in local pools (4, 8, 10, 13).

Calcitonin (CT) is a 32-amino acid peptide hormone, which is regulated by serum Ca2+ concentrations and secreted by C cells of the thyroid (26). Its receptor was identified as having C1a and C1b isoforms in rodents (29). Procalcitonin (PCT), the precursor for CT, is a 116-amino acid polypeptide in humans and a 110-amino acid polypeptide in rats, and it consists of aminoprocalcitonin, immature CT, and katacalcin. Mature CT is produced by posttranslational processing from PCT and carboxy-terminus amidation. PCT is encoded in CT mRNA (Fig. 1). It has recently been reported that the concentration of serum PCT is increased markedly with sepsis in humans and animals (2, 9, 22, 28, 33). Furthermore, the mortality in septic animals is increased by administration of PCT and decreased by neutralizing antiserum against PCT (24). These results indicate that PCT is a useful predictive marker and plays an important role in sepsis.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic model of procalcitonin (PCT). CT, calcitonin.

LPS activates the hypothalamic-pituitary-adrenal (HPA) axis, and it increases blood concentrations of cytokines, adrenocorticotropic hormone (ACTH), and glucocorticoids (34). In particular, the pituitary plays an important role in the immune regulation through various complex interactions between cytokines and neuroendocrine hormones, which originate at the pituitary and/or peripheral tissues (1, 20). Furthermore, it has been shown that mature CT or CT-like immunoreactivity and the functional receptors for CT exist in the pituitary (17, 27, 30-32). Therefore, we speculated that the pituitary is one of the sources of PCT in sepsis. In the present study, we examined the expression of CT mRNA in the LPS-administered rat pituitary to distinguish the source of PCT in sepsis.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and treatment. Adult male Wistar rats (250-280 g) were acclimated to standard laboratory conditions (12:12-h light-dark cycle at 22-24°C) with food and water ad libitum. All animal experiments were conducted in accordance with protocols approved by the Animal Care and Use Committee at Hokkaido University. Animals received 5 mg/kg of LPS from Escherichia coli serotype 055:B5 (Sigma Chemical, St. Louis, MO) or saline (same volume) intraperitoneally. The body temperature was monitored periodically by insertion of a thermistor probe into the rectum. Trunk blood stood for 30 min at room temperature and was centrifuged for 5 min at 3,000 rpm to obtain serum. Tissues and serum were stored at -80°C until assay.

ACTH and CT measurement. Concentrations of ACTH and total immunoreactive CT (iCT) in serum were determined by radioimmunoassay (RIA). An ACTH RIA kit was from Nichols Institute Diagnostics (San Juan Capistrano, CA), and a CT RIA kit, recognizing the mature type of CT, was from Mitsubishi Chemicals (Tokyo, Japan).

RT-PCR and probe preparation. Total RNAs of rat pituitary and hypothalamus homogenates were isolated by acid guanidinium thiocyanate-phenol-chloroform methods (7). Reverse transcriptase reactions were performed on 1 µg of RNA by use of SuperScript II reverse transcriptase (Life Technologies, Rockville, MD) at 42°C for 1 h. One-twentieth of the resulting cDNAs was subjected to PCR reaction with the Expand High Fidelity PCR system (Roche Molecular Biochemicals, Mannheim, Germany), with 200 nM of each dNTP and 300 nM of each forward and reverse primers for CT, CT receptor (CTR), IL-1beta , TNF-alpha , IL-6, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers were as follows


CT:   forward TGGAGCAGGAGGAGGAACAGG
reverse GAGGGACCTAGTTGCCAAAAT   CTR:
forward GTTGAGGTTGTGCCCAATGGA   reverse CCCTGGAAATGAATCAGAGAG
IL-1beta :   forward CCTTCTTTTCCTTCATCTTTG
reverse ACCGCTTTTCCATCTTCTTCT   IL-6:
forward CTTGGGACTGATGTTGTTGAC   reverse TCTGAATGACTCTGGCTTTGT
TNF-alpha :   forward GAAAGCATGATCCGAGATG
reverse AAAGTAGACCTGCCCGGACT   GAPDH:
forward AAACCCATCACCATCTTCCAG   reverse AGGGGCCATCCACAGTCTTCT

GAPDH was used as a control for the quality of the cDNA for each PCR reaction. The cycle consisted of denaturation (45 s at 94°C), annealing (45 s at 59°C), extension (1 min at 72°C), and 7 min of final extension at 72°C after amplification. The cycles were 30 for CT and cytokines, 35 for CTR, and 22 for GAPDH. PCR products were cloned using the pGEM-T vector system I (Promega, Madison, WI). The identity of the PCR products was verified by sequencing. Probes for Northern blotting were labeled using cloned PCR products as templates. Briefly, PCR was performed using 200 nM dATP, dGTP, and dTTP, and 0.1 mCi of [32P]dCTP instead of 200 nM of each dNTP.

Northern blot analysis. Northern blot analysis was performed by using a standard protocol. Briefly, 20 µg of total RNA were fractionated on 1% denaturing formaldehyde-agarose gels and then transferred to an Optitran-reinforced nitrocellulose filter (Schleicher & Schuell, Keene, NH). After baking at 80°C, the membranes were prehybridized for 2 h at 42°C in 50% formamide, 5× saline-sodium phosphate-EDTA (SSPE) buffer, 5× Denhardt's solution, 0.5% SDS, and 50 µg/ml salmon sperm DNA and then hybridized for 16 h at 42°C with 32P-labeled cDNA probes. After standard washing steps, the membranes were subjected to autoradiography. The blot was then reprobed with a GAPDH probe to confirm mRNA integrity.

Statistical analysis. Data are presented as means ± SE. Statistical significance was performed using one-way ANOVA followed by Dunnett's test unless otherwise indicated.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We analyzed the expression of CT mRNA or CTR mRNA in the unstimulated rat pituitary and hypothalamus by RT-PCR. The PCR product size was 228 base pairs (bp) for CT, 545 bp for C1a, 656 bp for C1b, and 361 bp for GAPDH. CT mRNA was detected in both the pituitary and the hypothalamus. CT mRNA in the pituitary was much more abundant than that present in the hypothalamus. C1a subtype mRNA was expressed in both the pituitary and the hypothalamus, whereas C1b subtype mRNA was expressed only in the hypothalamus (Fig. 2).


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2.   RT-PCR analysis of CT and CT receptor (CTR) mRNA expression in the pituitary and the hypothalamus. RT (-) indicates a negative control for each sample without reverse transcriptase. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control.

As shown in Fig. 3A, administration of 5 mg/kg LPS caused the body temperature to decrease, starting 1 h after administration and reaching a maximum at 1.5 h (37.00 ± 0.06°C). Within 2 h after LPS administration, the body temperature began to increase gradually, reaching a maximum at 7.5 h (38.57 ± 0.05°C) that lasted for 12 h (38.48 ± 0.1°C). The body temperature was not affected significantly by administration of saline. Moreover, serum levels of ACTH were measured by RIA (Fig. 3B). LPS administration resulted in a significant increase in levels of ACTH in serum, reaching 203.3 ± 42.6 pg/ml at 1.5 h. Levels then decreased after 3 h and dropped to 35.7 ± 10.9 pg/ml at 12 h. ACTH in serum was not detected in the saline-administered rats. We also examined the expression of proinflammatory cytokine mRNAs in the pituitary of LPS-administered rats. The expression of IL-1beta , IL-6, and TNF-alpha mRNAs increased to a maximum at 3 h. IL-1beta mRNA expression was sustained for 9 h and then decreased at 12 h after LPS administration. On the other hand, the decrease in TNF-alpha mRNA expression began at 9 h. Compared with the expression of IL-1beta and TNF-alpha mRNAs, the expression of IL-6 mRNA returned to basal levels at 9 h. The mRNA of cytokines in slight amounts can be detected in saline-administered rats at all time points (Fig. 3C). RT (-) negative control RT-PCR was performed for each sample (data not shown).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Physiological effects of lipopolysaccharide (LPS) on rats. A: time courses of rat body temperature after LPS () or saline (open circle ) administration. Data represent means ± SE of 12-20 animals in each group. *P < 0.05 and **P < 0.01 compared with saline at the same time point. B: time courses of serum ACTH levels after LPS () or saline (open circle ) administration. Data are means ± SE of 3 animals in each group. Statistical analysis was performed by 1-way ANOVA followed by a Fisher's protected least significant difference test **P < 0.01 compared with saline at the same time point. C: RT-PCR analysis of interleukin (IL)-1beta , IL-6, and tumor necrosis factor (TNF)-alpha mRNA expression in the pituitary after LPS or saline administration.

An increase in serum levels of total iCT was observed at 6 h after LPS administration (51.3 ± 3.5 pg/ml) and continued until 12 h (66.7 ± 9.2 pg/ml). Serum levels of total iCT in the saline-administered rats ranged from 40 to 45 pg/ml at all time points (Fig. 4). To investigate the effect of LPS administration on CT mRNA expression in the pituitary, total RNA in the pituitary was subjected to Northern blot analysis. Similar to serum levels of iCT, the expression of CT mRNA was increased beginning at 6 h and sustained until 12 h after LPS administration. A small amount of CT mRNA was expressed in the saline-administered rats (Fig. 5). CT mRNA in the hypothalamus was not detected by Northern blotting analysis (data not shown).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Time courses of serum CT levels after LPS () or saline (open circle ) administration. Data are means ± SE of 4-6 animals in each group. *P < 0.05 compared with saline at the same time point.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 5.   Time courses of CT mRNA expression in the pituitary after LPS or saline administration. Total RNA was extracted at each time point, and the expression of CT mRNA was analyzed by Northern blotting. One representative experiment, repeated 3 times under similar conditions, is shown.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Many inflammatory mediators and acute-phase reactants, such as proinflammatory cytokines or C-reactive protein, have been used as indicators of sepsis, but these substances are not specific for sepsis: they are increased in inflammation without infection, such as trauma (4, 8, 10, 13). However, PCT is selectively induced in sepsis or multiorgan dysfunction syndrome (2, 9, 22, 28, 33). Therefore, PCT is now considered to be the specific indicator of sepsis.

PCT is physiologically produced as the precursor molecule of CT in the parafollicular cells of the thyroid gland. However, PCT in serum is detected in thyroidectomized patients during bacterial infection (2). Hence, another organ is considered as the source of PCT in sepsis. As it has been reported (17, 27, 30-32), mature CT peptide or CT-like immunoreactivity and functional receptors for CT are present in the pituitary and hypothalamus, and CT and its receptor mRNAs were expressed in the normal pituitary and hypothalamus (Fig. 2). Although a specific receptor for PCT has not been identified, an immunoreactive protein whose molecular weight is close to PCT binds to CTR (3, 16). These findings suggest the existence of an ultra-short regulatory loop between the hypothalamus and the pituitary and an autocrine regulation within both tissues by PCT and/or CT. CT mRNA was much more abundant in the pituitary than in the hypothalamus. Furthermore, the pituitary directory controls physiological conditions by secreting peptide hormones into the blood. Therefore, we considered that the pituitary might be one of the sources of serum PCT in sepsis.

Because the body temperature, ACTH, and proinflammatory cytokines are increased in sepsis (18, 19, 24), we confirmed that LPS (5 mg/kg ip) induced an increase in body temperature, serum ACTH levels, and mRNA expression of IL-1beta , IL-6, and TNF-alpha in the pituitary (Fig. 3, A-C). Thus this dose of LPS was used for the model of sepsis in the present study. After LPS administration, serum levels of total iCT were significantly elevated (Fig. 4). Although serum PCT levels were significantly increased in sepsis, mature CT levels were limited from normal to minimally elevated in humans and rodents (23, 25). Therefore, increased serum levels of iCT in LPS-administered rats are speculated to be PCT. Moreover, the expression of CT mRNA in the pituitary was markedly increased from 6 h and lasted to 12 h after LPS administration (Fig. 5). The time course of increased CT mRNA expression by LPS was parallel to that of increased serum iCT by LPS. These results imply that the pituitary is one of the sources of increased serum PCT in sepsis. Recently, increased CT mRNA in sepsis models was detected in other tissues and the peripheral blood cells by RT-PCR (23, 35). CT mRNA in the mononuclear cells was stimulated by LPS as well as proinflammatory cytokines, such as IL-1beta , IL-6, and TNF-alpha (25). In addition, PCT decreased LPS-induced TNF-alpha (15, 21). Because LPS stimulated CT mRNA in addition to IL-1beta , IL-6, and TNF-alpha mRNAs in the pituitary, an interaction between PCT and/or CT and cytokines may exist in the pituitary. In particular, macrophage migration inhibitory factor (MIF), one of the first cytokines to be discovered, has been shown to have a similarity to PCT during sepsis. 1) MIF is secreted by inflammatory stimuli, cytokines, and stress-induced activation of the HPA axis and is considered to be one of the septic markers (12). 2) MIF is induced in the pituitary and monocytes/macrophages during sepsis (12, 24). 3) Neutralization of MIF protects from septic shock (6). Therefore, it is tempting to speculate that the correlations between PCT and MIF exist in the pituitary and/or peripherals during sepsis.

In summary, we have demonstrated that CT mRNA was expressed in the rat pituitary. Moreover, we have shown that LPS stimulated the pituitary, followed by an increase in serum iCT and CT mRNA induction in the pituitary.


    FOOTNOTES

Address for reprint requests and other correspondence: Y. Tokumitsu, Health Sciences, Univ. of Hokkaido, Ishikari-Tobetsu, 061-0293 Japan (E-mail: tyukiko{at}hoku-iryo-u.ac.jp or ytokumitsu{at}yahoo.co.jp).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpendo.00453.2001

Received 10 October 2001; accepted in final form 22 January 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Arzt, E, Pereda MP, Castro CP, Pagotto U, Renner U, and Stalla GK. Pathophysiological role of the cytokine network in the anterior pituitary gland. Front Neuroendocrinol 20: 71-95, 1999[Web of Science][Medline].

2.   Assicot, M, Gendrel D, Carsin H, Raymond J, Guilbaud J, and Bohuon C. High serum procalcitonin concentrations in patients with sepsis and infection. Lancet 341: 515-518, 1993[Web of Science][Medline].

3.   Becker, KL, Bivins LE, Radfar RH, Snider RH, Moore CF, and Silva OL. Study of calcitonin heterogeneity using a radioreceptor assay. Horm Metab Res 10: 457-458, 1978[Web of Science][Medline].

4.   Bone, RC. Toward a theory regarding the pathogenesis of the systemic inflammatory response syndrome: what we do and do not know about cytokine regulation. Crit Care Med 24: 163-172, 1996[Web of Science][Medline].

5.   Burrell, R. Human responses to bacterial endotoxin. Circ Shock 43: 137-153, 1994[Web of Science][Medline].

6.   Calandra, T, Echtenacher B, Roy DL, Pugin J, Metz CN, Hultner L, Heumann D, Mannel D, Bucala R, and Glauser MP. Protection from septic shock by neutralization of macrophage migration inhibitory factor. Nat Med 6: 164-170, 2000[Web of Science][Medline].

7.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

8.   Creasey, AA, Stevens P, Kenney J, Allison AC, Warren K, Catlett R, Hinshaw L, and Taylor FB, Jr. Endotoxin and cytokine profile in plasma of baboons challenged with lethal and sublethal Escherichia coli. Circ Shock 33: 84-91, 1991[Web of Science][Medline].

9.   Dandona, P, Nix D, Wilson MF, Aljada A, Love J, Assicot M, and Bohuon C. Procalcitonin increase after endotoxin injection in normal subjects. J Clin Endocrinol Metab 79: 1605-1608, 1994[Abstract].

10.   DeForge, LE, and Remick DG. Kinetics of TNF, IL-6, and IL-8 gene expression in LPS-stimulated human whole blood. Biochem Biophys Res Commun 174: 18-24, 1991[Web of Science][Medline].

11.   Dellinger, RP. (Chairman). From the bench to the bedside: the future of sepsis research. Executive summary of an American College of Chest Physicians, National Institute of Allergy and Infectious Disease, and National Heart, Lung, and Blood Institute Workshop. Chest 111: 744-753, 1997[Free Full Text].

12.   Fingerle-Rowson, GR, and Bucala R. Neuroendocrine properties of macrophage migration inhibitory factor (MIF). Immunol Cell Biol 79: 368-375, 2001[Medline].

13.   Givalois, L, Dornand J, Mekaouche M, Solier MD, Bristow AF, Ixart G, Siaud P, Assenmacher I, and Barbanel G. Temporal cascade of plasma level surges in ACTH, corticosterone, and cytokines in endotoxin-challenged rats. Am J Physiol Regulatory Integrative Comp Physiol 267: R164-R170, 1994[Abstract/Free Full Text].

14.   Hasday, JD, Fairchild KD, and Shanholtz C. The role of fever in the infected host. Microbes Infect 2: 1891-1904, 2000[Web of Science][Medline].

15.   Hoffmann, G, and Schobersberger W. Anti-inflammatory procalcitonin (PTC) in a human whole blood model septic shock. Cytokine 14: 127-128, 2001[Web of Science][Medline].

16.   Jullienne, A, Raulais D, Calmettes C, Moukhtar MS, and Milhaud G. Heterogeneity of immunoreactive calcitonin in normal human thyroid. Horm Metab Res 10: 456-457, 1978[Web of Science][Medline].

17.   Kiriyama, Y, Tsuchiya H, Murakami T, Satoh K, and Tokumitsu Y. Calcitonin induces IL-6 production via both PKA and PKC pathways in the pituitary folliculo-stellate cell line. Endocrinology 142: 3563-3569, 2001[Abstract/Free Full Text].

18.   Kozak, W, Zheng H, Conn CA, Soszynski D, van der Ploeg LH, and Kluger MJ. Thermal and behavioral effects of lipopolysaccharide and influenza in interleukin-1 beta -deficient mice. Am J Physiol Regulatory Integrative Comp Physiol 269: R969-R977, 1995[Abstract/Free Full Text].

19.   Laye, S, Parnet P, Goujon E, and Dantzer R. Peripheral administration of lipopolysaccharide induces the expression of cytokine transcripts in the brain and pituitary of mice. Brain Res Mol Brain Res 27: 157-162, 1994[Medline].

20.   McCann, SM, Kimura M, Karanth S, Yu WH, Mastronardi CA, and Rettori V. The mechanism of action of cytokines to control the release of hypothalamic and pituitary hormones in infection. Ann NY Acad Sci 917: 4-18, 2000[Web of Science][Medline].

21.   Monneret, G, Pachot A, Laroche B, Picollet J, and Bienvenu J. Procalcitonin and calcitonin gene-related peptide decrease LPS-induced tnf production by human circulating blood cells. Cytokine 12: 762-764, 2000[Web of Science][Medline].

22.   Muller, B, Becker KL, Schachinger H, Rickenbacher PR, Huber PR, Zimmerli W, and Ritz R. Calcitonin precursors are reliable markers of sepsis in a medical intensive care unit. Crit Care Med 28: 977-983, 2000[Web of Science][Medline].

23.   Muller, B, White JC, Nylen ES, Snider RH, Becker KL, and Habener JF. Ubiquitous expression of the calcitonin-i gene in multiple tissues in response to sepsis. J Clin Endocrinol Metab 86: 396-404, 2001[Abstract/Free Full Text].

24.   Nylen, ES, Whang KT, Snider RH, Steinwald PM, White JC, and Becker KL. Mortality is increased by procalcitonin and decreased by an antiserum reactive to procalcitonin in experimental sepsis. Crit Care Med 26: 1001-1006, 1998[Web of Science][Medline].

25.   Oberhoffer, M, Stonans I, Russwurm S, Stonane E, Vogelsang H, Junker U, Jager L, and Reinhart K. Procalcitonin expression in human peripheral blood mononuclear cells and its modulation by lipopolysaccharides and sepsis-related cytokines in vitro. J Lab Clin Med 134: 49-55, 1999[Web of Science][Medline].

26.   Raue, F, Zink A, and Scherubl H. Regulation of calcitonin secretion in vitro. Horm Metab Res 25: 473-476, 1993[Web of Science][Medline].

27.   Ren, Y, Chien J, Sun YP, and Shah GV. Calcitonin is expressed in gonadotropes of the anterior pituitary gland: its possible role in paracrine regulation of lactotrope function. J Endocrinol 171: 217-228, 2001[Abstract].

28.   Selberg, O, Hecker H, Martin M, Klos A, Bautsch W, and Kohl J. Discrimination of sepsis and systemic inflammatory response syndrome by determination of circulating plasma concentrations of procalcitonin, protein complement 3a, and interleukin-6. Crit Care Med 28: 2793-2798, 2000[Web of Science][Medline].

29.   Sexton, PM, Houssami S, Hilton JM, O'Keeffe LM, Center RJ, Gillespie MT, Darcy P, and Findlay DM. Identification of brain isoforms of the rat calcitonin receptor. Mol Endocrinol 7: 815-821, 1993[Abstract/Free Full Text].

30.   Shah, GV, Chien J, Sun YP, Puri S, and Ravindra R. Calcitonin inhibits anterior pituitary cell proliferation in the adult female rats. Endocrinology 140: 4281-4291, 1999[Abstract/Free Full Text].

31.   Shah, GV, Deftos LJ, and Crowley WR. Synthesis and release of calcitonin-like immunoreactivity by anterior pituitary cells: evidence for a role in paracrine regulation of prolactin secretion. Endocrinology 132: 1367-1372, 1993[Abstract/Free Full Text].

32.   Sheward, WJ, Lutz EM, and Harmar AJ. The expression of the calcitonin receptor gene in the brain and pituitary gland of the rat. Neurosci Lett 181: 31-34, 1994[Web of Science][Medline].

33.   Steinwald, PM, Whang KT, Becker KL, Snider RH, Nylen ES, and White JC. Elevated calcitonin precursor levels are related to mortality in an animal model of sepsis. Crit Care (Lond) 3: 11-16, 1999.

34.   Turnbull, AV, and Rivier CL. Regulation of the hypothalamic-pituitary-adrenal axis by cytokines: actions and mechanisms of action. Physiol Rev 79: 1-71, 1999[Abstract/Free Full Text].

35.   Whang, KT, Steinwald PM, White JC, Nylen ES, Snider RH, Simon GL, Goldberg RL, and Becker KL. Serum calcitonin precursors in sepsis and systemic inflammation. J Clin Endocrinol Metab 83: 3296-3301, 1998[Abstract/Free Full Text].


Am J Physiol Endocrinol Metab 282(6):E1380-E1384
0193-1849/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Clodi, G. Vila, R. Geyeregger, M. Riedl, T. M. Stulnig, J. Struck, T. A. Luger, and A. Luger
Oxytocin alleviates the neuroendocrine and cytokine response to bacterial endotoxin in healthy men
Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E686 - E691.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
J. M. McClung, J. M. Davis, and J. A. Carson
Muscle: Ovarian hormone status and skeletal muscle inflammation during recovery from disuse in rats
Exp Physiol, January 1, 2007; 92(1): 219 - 232.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiriyama, Y.
Right arrow Articles by Tokumitsu, Y.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kiriyama, Y.
Right arrow Articles by Tokumitsu, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online