|
|
||||||||
B on 1,25-dihydroxyvitamin
D3 and retinoid X receptor function
1 Division of Endocrinology and Metabolism, Department of Medicine, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, Georgia, 30033; and 2 German Cancer Research Center, D-69120 Heidelberg, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Responsiveness to 1,25-dihydroxyvitamin
D3 [1,25(OH)2D3] may be
diminished in osteoporosis and inflammatory arthritis. The inflammatory
cytokine tumor necrosis factor-
(TNF-
) is produced in excess in
these disorders and has been shown to decrease osteoblast transcriptional responsiveness to vitamin D and to inhibit the binding
of the vitamin D receptor (VDR) and its nuclear partner the retinoid X
receptor (RXR) to DNA. Previous studies have shown that a vitamin D
(VDRE) or retinoid X DNA response element (RXRE) is sufficient to
confer TNF-
inhibition of vitamin D or retinoid-stimulated transcription in the absence of known TNF-
-responsive DNA sequences. We tested the hypothesis that the TNF-
-stimulated transcription factor nuclear factor (NF)-
B could, in part, mediate TNF-
action by inhibiting the transcriptional potency of the VDR and RXR at their
cognate cis regulatory sites. Osteoblastic ROS 17/2.8 cells transfected with a dose of NF-
B comparable to that stimulated by
TNF-
decreased 1,25(OH)2D3-stimulated
transcription. This inhibitory effect of NF-
B was not observed on
basal transcription of a heterologous reporter in the absence of the
VDRE. The effects of NF-
B and TNF-
were comparable but not
additive. COS-7 cells were cotransfected with reporters under the
regulation of VDRE or RXRE along with vectors expressing VDR, RXR, and
NF-
B nuclear proteins. Reconstituted NF-
B and the NF-
B subunit
p65 alone, but not p50, dose dependently suppressed basal and
ligand-stimulated transcription. p65 overexpression completely
abrogated enhanced VDRE-mediated transcriptional activity in response
to 1,25(OH)2D3. Electrophoretic mobility shift
experiments did not reveal a direct effect of recombinant NF-
B or
its individual subunits on the binding of heterodimeric VDR-RXR to DNA.
These results suggest that TNF-
inhibition of hormone-stimulated
transcriptional activation may be mediated by activation of NF-
B. In
contrast, the inhibitory effect of TNF-
on binding of receptors to
DNA is unlikely to be mediated by NF-
B and is not necessary for
inhibition of transcription.
nuclear factor-
B; tumor necrosis factor-
; vitamin D receptor; vitamin D
| |
INTRODUCTION |
|---|
|
|
|---|
CROSS TALK BETWEEN
DIFFERENT intracellular signaling pathways is important for the
coordination of cell regulatory signals. The proinflammatory cytokine
tumor necrosis factor-
(TNF-
) is a pleiotropic regulator that has
an important role in the pathophysiology of numerous disorders,
including osteoporosis and periarticular bone loss in inflammatory
arthritis (5). In these disorders, TNF-
is expressed in
excess, and blocking TNF-
action prevents bone loss (1,
17, 19). At the cellular level, TNF-
inhibits the production of important skeletal matrix proteins by
osteoblasts and activates the recruitment of bone-resorbing osteoclasts
from their progenitor cells (22). TNF-
may also cause
resistance to 1,25-dihydroxyvitamin D3
[1,25(OH)2D3], a secosteroid required for
optimum fractional absorption of calcium by the intestine, a process
that is decreased in osteoporosis, contributing to bone loss over time
(18, 32, 33). Resistance to
vitamin D also impairs stimulation of osteocalcin production by
osteoblasts and suppresses the expression of
3-integrin,
proteins that are needed for cell matrix recognition in bone
(1-4, 6). TNF-
could contribute
toward bone loss in osteoporosis and inflammatory arthritis, in part,
by stimulating cell resistance to 1,25(OH)2D3.
TNF-
controls the expression of a number of inflammatory and immune
regulatory genes through activation of the nuclear transcription factor
kappa B (NF-
B). NF-
B has been shown to function predominantly as
a heterodimer of p65 (RelA) and p50 (RelB1). A classic pathway has been
delineated in which receptor-bound TNF-
stimulates a kinase cascade
that phosphorylates a large cytoplasmic multiprotein complex containing
the inhibitor of NF-
B (I
B)-
protein (10, 25, 28). The TNF-
-induced
NH2-terminal phosphorylation of I
B liberates NF-
B
from this complex for nuclear translocation. Prototypical NF-
B is a
heterodimeric transcription factor consisting of the p50 (NF-
B1) and
p65 (RelA) subunits. Nuclear binding of NF-
B to its cognate DNA
response element and resulting transcriptional stimulation have been
described for a variety of genes, including intracellular
adhesion molecule (3, 8), interleukins
(IL-2, IL-6, IL-8; see Refs. 21, 36, 42), and the human
immunodeficiency-1 virus long terminal repeat (6,
11, 23, 37). In these examples
of NF-
B-mediated gene regulation, the effects of TNF-
are
generally stimulatory. Less is known about the inhibitory effects of
TNF-
on transcription, particularly with regard to skeletal matrix proteins.
Our laboratory has described an inhibitory effect of TNF-
on the
transcription of osteocalcin, a vitamin D-stimulated skeletal protein
that is a unique product of mature osteoblasts (31). Vitamin D stimulation of the osteocalcin gene is mediated by binding of
the vitamin D receptor (VDR), a member of the thyroid/steroid hormone
nuclear receptor superfamily. The VDR binds to DNA as a heterodimer
with the retinoid X receptor (RXR), another member of the nuclear
receptor superfamily. TNF-
treatment of osteoblasts inhibits binding
of the RXR/VDR heterodimer to the vitamin D response element (VDRE) and
inhibits VDR-mediated transcriptional activation of the osteocalcin
gene. Deletion analysis of the osteocalcin promoter revealed that the
VDRE alone was sufficient to confer both transcriptional activation by
the VDR and inhibition by TNF-
. This conclusion was also confirmed
by using a heterologous minimal promoter containing a single copy of
the osteocalcin VDRE (20, 30,
31). TNF-
-induced de novo synthesis of other protein mediators is unlikely to cause the inhibitory effect of TNF-
on VDR
function, because the effect is rapid and persists in the presence of
cycloheximide (12). We recently reported that TNF-
also
inhibits transcriptional activation of a heterologous promoter-reporter construct containing an upstream RXR response element (RXRE) that binds
an RXR homodimer (12). These results suggest that
extensive cross talk may exist between one or more signaling molecules
in TNF-
-stimulated pathways and members of the vitamin D/nuclear receptor superfamily.
Because NF-
B mediates many effects of TNF-
, we hypothesized that
NF-
B might mediate TNF-
-induced inhibition of VDR and RXR
function. NF-
B exists preformed in the cytoplasm. Therefore, new
protein synthesis would not be required for its mediation of TNF-
inhibitory action. Here we report that NF-
B does indeed inhibit
VDRE- or RXRE-dependent transcription through a p65-dependent mechanism. Surprisingly, p65 inhibition of vitamin D- or
retinoid-stimulated transcription is not associated with inhibition of
nuclear receptor binding to DNA, suggesting that NF-
B does not
account for all of the TNF-
action on nuclear hormone receptors.
| |
METHODS |
|---|
|
|
|---|
Reagents.
Recombinant human TNF-
was purchased from R&D Systems (Minneapolis,
MN) or Peprotech (Rocky Hill, NJ). 1,25(OH)2D3
and 9-cis-retinoic acid (9cisRA) were obtained from BioMol
(Plymouth Meeting, PA) and Sigma (St. Louis, MO), respectively. A
double-stranded consensus NF-
B oligonucleotide probe and purified
recombinant NF-
B p50 protein were obtained from Promega (Madison,
WI). The VDRE oligonucleotide probe used in gel shift assays was
synthesized in the Emory University Microchemical Facility
(20). Recombinant human VDR was obtained from Affinity
BioReagents (Golden, CO). All polyclonal antibodies directed against
NF-
B proteins were obtained from Santa Cruz (Santa Cruz, CA).
4RX-3A2.1.1 RXR and the IVG8C11 VDR antibodies were obtained from Drs.
P. Chambon (Institut de Genetique et de Biologie Moleculaire et
Cellulaire, Illkirch, France) and H. DeLuca (Univ. of Wisconsin).
[
-32P]ATP and [14C]chloramphenicol were
obtained from Amersham (Arlington Heights, IL) and New England Nuclear
(Boston, MA), respectively. Other reagents for cell culture, buffers,
and enzymes were obtained from commercial sources.
Plasmids and protein expression.
The VDRE2TKCAT plasmid provided by Dr. M. Demay
(Massachusetts General Hospital, Boston, MA) contains two copies of a
VDRE from the rat osteocalcin gene located upstream from a minimal thymidine kinase (TK) promoter and a bacterial chloramphenicol acetyltransferase (CAT) reporter (original plasmid designation: 1D3#4). This construct was selected because the two
backward-facing VDRE copies from the rat osteocalcin promoter provide
greater responsiveness to 1,25(OH)2D3 treatment
than does a single response element (9, 30).
The RXRE-CAT containing a single RXRE direct repeat from the RXRE
multimer found in the cellular retinol binding-protein II gene promoter
was described previously (12). The pGEX-2TK prokaryotic
expression vector and the pSPUTK in vitro translation vector were
obtained from Pharmacia Biotech (Piscataway, NJ) and Stratagene (La
Jolla, CA), respectively. The pSV40-
-galactosidase and the pBLCAT2
plasmids were obtained from Promega. The pRcCMV2 control vector was
purchased from Invitrogen (San Diego, CA). Cytomegalovirus (CMV)-driven
eukaryotic expression vectors for human VDR and human RXR
were
courtesy of Dr. L. Freedman (Sloan Kettering, NY). The CMV-driven
expression vectors for human p50 and c-Rel and the
(
B)6-luciferase reporter construct were described previously (14, 16, 39). Dr. T. Maniatis (Harvard University, Boston, MA) provided the pRcCMV-p65
vector. A CMV-driven control plasmid encoding Renilla luciferase was
obtained from Promega.
cDNA contained in pRcCMV2-hRXR
(sense primer:
ccggaattcttatggacaccaaacatttcctgccgc; antisense primer:
ccggaattctctaagtcatttggtgcggcg). This PCR product was cloned directly
into a pGEM-T vector, excised with EcoR I, and ligated to
the pGEX-2TK vector. Induced expression of the GST-hRXR
fusion
protein in Escherichia coli, chromatographic purification,
and enzymatic cleavage to release full-length hRXR
protein were
accomplished according to instructions from the manufacturer (Pharmacia). Similarly, BamH I-containing primers were used
to amplify the human NF-
B p65 cDNA contained in the pRcCMV2-p65 plasmid (sense primer: cgcgcggatccaccatggacgaactgttccccctc; antisense primer: cgcgcggatccttaggagctgatctgactcag). The BamH I-cut
PCR fragment was ligated to a Bgl II-linearized pSPUTK
plasmid (compatible ends). This in vitro translation plasmid was used
to program a quick-coupled transcription/translation wheat germ system
(Promega). The identity of the translated product was verified using a
Western blot and the enhanced chemiluminescence detection kit
(Amersham). Some translations included [35S]methionine to
electrophoretically confirm expression of full-length p65.
Cell culture, transient transfection, and transcription assays.
COS-7 cells originally obtained from the American Type Culture
Collection (Rockville, MD) were selected because they are VDR deficient
and provide a low background of RXR
and NF-
B compared with many
other cells (38). The COS cells were seeded at 1 × 105/60-mm dish and were incubated for 48 h in MEM
(Life Technologies, Grand Island, NY) supplemented with 10% FBS
(Hyclone, Logan, UT). Cells were then transiently transfected for
4 h in serum-free DMEM using a 1:5 mass ratio of DNA to Lipofectin
according to the manufacturer's specifications (Life Technologies).
The final serum concentration was adjusted to 2% by addition of an
equivalent volume of MEM containing 4% FBS. Depending on the protocol,
this medium was supplemented by inclusion of 100 ng/ml TNF-
, 1 µM 9cisRA, or 10 nM 1,25(OH)2D3. Fresh medium
containing TNF-
or ligand was applied the next morning. Cell
extracts for reporter assays or nuclear extracts for electrophoretic
mobility shift assay (EMSA) were harvested 48 h posttransfection.
Expression vectors encoding nuclear receptors or NF-
B subunits were
cotransfected in the amounts indicated for each experiment along with 4 µg of VDRE2TKCAT or RXRE-CAT reporter plasmids.
Differences in cell number or transfection efficiency were controlled
for by inclusion of either pSV-
-galactosidase or the CMV-Renilla
plasmids. Total transfected DNA was held constant by inclusion of
variable amounts of nonspecific plasmid. CAT activity was measured as
previously described (40). Background CAT activity in
assays was <5%. Transcriptional activity was calculated and expressed
as (CAT
background)/
-galactosidase.
Nuclear extract isolation and EMSA.
A rapid isolation of nuclear proteins was achieved using a procedure
developed specifically for COS-7 cells (2). This method entails hypotonic lysis of cells coupled with high salt extraction of
proteins from pelleted nuclei. Nuclear extracts were divided into
aliquots, snap-frozen in liquid nitrogen, and stored at
70°C. Protein concentrations were determined using a Bio-Rad reagent and BSA
standards from Pierce (Rockford, IL).
-32P]ATP in an imidazole
buffer. Reactions were quenched by the addition of 25 mM EDTA. Probes
were then extracted with chloroform and purified on Quick Spin G50
columns (Boehringer Mannheim, Indianapolis, IN) to remove
unincorporated ATP. Each 20-µl binding reaction was initiated on ice
and contained a defined amount of nuclear protein in a buffer
containing 10 mM HEPES-KOH (pH 7.9), 84 mM NaCl, 50 mM KCl, 0.2 mM
EDTA, 2.5 mM dithiothreitol, 10% glycerol, 0.05% Nonidet P-40, and
0.05 µg/ml poly(dI-dC). When antiserum was added to induce
supershifts, reactions were incubated an additional 20 min on ice.
After addition of probe, samples were incubated another 30 min at room
temperature. A native 5% polyacrylamide gel prepared with 1× TGE
buffer, pH 8.5 (10× TGE stock contains 30 g Tris base, 147.2 g
glycine, and 3.99 g EDTA-Na2/l) was prerun at 4°C
and 100 volts during this incubation. Samples were electrophoresed for
15 min at 100 volts, followed by an additional 60 min at 200 volts
without recirculating the 1× TGE running buffer.
Statistics. Differences between multiple treatments were detected using one-way ANOVA. The Student-Newman-Keuls method was used for multiple comparisons among groups. Dunnett's test was employed for multiple comparisons between a control and several treatment groups. A confidence level of 0.05 was selected for all statistical analyses. Statistical analyses were performed using SigmaStat version 1.0 (SPSS, Chicago, IL).
| |
RESULTS |
|---|
|
|
|---|
Verification of NF-
B expression.
The successful transfection and expression of NF-
B subunits was
verified in nuclear extracts from COS-7 cells using an EMSA that
employed a labeled consensus NF-
B probe and specific antiserum to
supershift DNA-protein complexes (Fig.
1A). Lane 1 shows
unhindered migration of the free probe in the absence of nuclear
extract. Lane 2 shows only nonspecific binding of probe to
nuclear extract from untransfected control cells. Transfection with the
p50 expression vector produced a retarded band (lane 3) that
was completely supershifted upon addition of p50-specific antiserum
(lane 4). The intensity of this complex reflected both
abundant nuclear p50 protein and a strong binding affinity between the
p50 homodimer and the DNA response element. At least two faint retarded
bands, both exhibiting reduced gel mobilities compared with p50, were
observed in nuclear extracts from p65-transfected cells (lane
5). One of these bands comigrated with a DNA-protein complex
produced by TNF-
treatment, indicating that this complex contained a
heterodimer consisting of plasmid-encoded p65 and a small amount of
endogenous p50. Because a p65-specific antiserum supershifted both
bands, the second larger complex probably contained a p65 homodimer
(lane 6). Simultaneous transfection of both subunits (i.e.,
reconstituted NF-
B) produced a pattern similar to that caused by
TNF-
in terms of the positions of the retarded bands (lane
7). However, transfection yielded far greater levels of nuclear
NF-
B and the putative p50 homodimer than did treatment with TNF-
(lane 8). Out of a panel of five Rel family-specific
antisera and one control antiserum directed against c-Fos, only the p50
and p65 antisera produced supershifts, implying that TNF-
-stimulated
NF-
B in COS-7 cells is primarily a p50-p65 heterodimer (lanes
9-14).
|
B-responsive elements, is devoid of DNA-binding
potential (34). Nevertheless, to guarantee that expression
of p65 caused nuclear translocation of an active p65 moiety, a
(
B)6-luciferase reporter was transfected alone or in combination with the p65 expression vector. The p65 vector caused a
>35-fold increase in reporter activity compared with a 50-fold induction achieved by TNF-
(Fig.
2B). These observations
indicate that both the amount and the activity of nuclear p65, the
transcriptionally active subunit of NF-
B, were increased by
transfection with the CMV-driven expression vector.
|
TNF-
and NF-
B block VDRE-dependent reporter activity.
To evaluate whether expression of reconstituted NF-
B mimics TNF-
inhibition of VDRE-dependent activity, osteoblastic ROS 17/2.8 cells
were transfected with both subunits plus a VDRE reporter. CMV-driven
expression vectors encoding VDR and RXR were cotransfected to avoid
decreased reporter activity that might arise from TNF-
inhibition of
receptor abundance (26). ROS cells were selected for this
comparison because, unlike in COS-7 cells, where nuclear NF-
B from
transfection may greatly exceed that obtained from TNF-
stimulation,
both transfection and TNF-
produce similar levels of nuclear NF-
B
in these rat osteosarcoma cells (data not shown).
blocked the 1,25(OH)2D3-stimulated increase by ~30%. Expression of the two NF-
B subunits similarly blocked 1,25(OH)2D3-stimulated transcription.
Combined treatment with TNF-
and NF-
B expression was not
additive, suggesting that TNF-
-induced suppression may have
occurred, in part, through NF-
B activation.
NF-
B inhibition requires a hormone response element.
To rule out nonspecific or generalized effects of NF-
B on
transcription, a pBLCAT2 plasmid containing a minimal TK promoter and
CAT reporter, similar to that in VDRE2TKCAT but lacking
hormone response elements, was transfected in parallel with
the VDRE2TKCAT reporter. As expected, treatment
with 1,25(OH)2D3 caused a 2.5-fold increase in VDRE2TKCAT activity but did not stimulate
activity from pBLCAT2 (Fig. 3). Both
basal and 1,25(OH)2D3-stimulated activities from VDRE2TKCAT were inhibited ~50% by NF-
B. However,
NF-
B had no effect on basal activity from pBLCAT2. Thus NF-
B
inhibition of basal and hormone-stimulated transactivation required the
presence of a VDRE sequence.
|
NF-
B confers dose-dependent inhibition of VDRE- and
RXRE-dependent activity.
Because COS-7 cells represented a more responsive system for evaluating
NF-
B effects on hormone-dependent reporter activity, these cells
were transfected with varying amounts of the expression vectors
encoding the NF-
B subunits together with vectors encoding RXR and
VDR and a VDRE2TKCAT reporter. As seen in Fig.
4, VDRE-directed CAT activity increased
2.5- to 3.5-fold in response to 1,25(OH)2D3. Both basal and 1,25(OH)2D3-stimulated CAT
activities were dose dependently suppressed in response to either p65
alone or p65 in conjunction with p50 (i.e., NF-
B).
1,25(OH)2D3 stimulated VDRE-dependent activity
above unstimulated levels at each of the five NF-
B doses. However,
hormone-dependent stimulation was gradually lost in cells transfected
with p65 alone. A small increase in both unstimulated and
1,25(OH)2D3-stimulated activity occurred with
increasing p50. However, significantly elevated levels were only
observed at the highest doses of this expression vector. The p50 doses
used to achieve this modest stimulation were at least one order of
magnitude higher than the levels of p65 or NF-
B required to inhibit
basal and 1,25(OH)2D3-stimulated activity.
|
B subunits on RXR-dependent transcription. In this case, however,
an RXRE-TKCAT reporter was transfected instead of
VDRE2TKCAT, and the VDR expression vector was excluded to
prevent competitive formation of VDR-RXR heterodimers in these
VDR-deficient cells. In addition, cells were exposed to the RXR-cognate
ligand 9cisRA instead of 1,25(OH)2D3. An
approximate doubling of RXRE-dependent reporter activity occurred in
response to 9cisRA (Fig. 5). Expression of p50 failed to alter basal or 9cisRA-stimulated activity. In contrast, both p65 alone and reconstituted NF-
B caused similar dose-dependent suppression of basal and ligand-stimulated activity, again raising suspicion that p65 might be the active inhibitory subunit
within NF-
B. Interestingly, 9cisRA continued to stimulate RXRE-TKCAT
activity at the highest p65 dose, whereas
1,25(OH)2D3 stimulation of
VDRE2TKCAT activity was abolished at this same DNA
concentration.
|
NF-
B does not influence binding of VDR/RXR heterodimers to DNA.
Because TNF-
perturbs binding of VDR and RXR to their cognate DNA
response elements, we examined whether the NF-
B subunits might
directly block the nuclear receptors from binding to DNA (12). Purified forms of recombinant human RXR and VDR
proteins were assessed for their ability to bind a VDRE either alone or in the presence of recombinant p50 or p65. EMSA revealed that the
combination of RXR and VDR produced strong binding to a VDRE probe, but
neither receptor interacted strongly with the DNA by itself (Fig.
6). The identity of the RXR-VDR
heterodimer was established using VDR and RXR antibodies that either
blocked protein-DNA interactions or supershifted the protein-DNA
complex, respectively. Neither recombinant p65 protein that had been
translated using an efficient wheat germ extract nor highly purified
p50 produced in baculovirus-infected Sf9 insect cells showed any
evidence of direct binding to this VDRE probe. Similarly, neither
NF-
B subunit, when incubated with the two nuclear receptors, caused
any change in DNA binding of the nuclear receptors.
|
| |
DISCUSSION |
|---|
|
|
|---|
These experiments were performed to evaluate whether TNF-
inhibition of receptor-dependent transactivation might be mediated in
part by NF-
B or its protein subunits. The strong expression of p50
and p65 by our CMV promoter-driven vectors was sufficient to overwhelm
cytosolic I
B binding capacity, thereby allowing functional p65/p50
translocation to the nucleus. We report here that expression of p65 or
p65 in conjunction with p50 (NF-
B) caused dose-dependent declines in
basal and hormone-activated VDRE- and RXRE-dependent reporter activity.
Our data suggested that the p65 subunit of NF-
B conferred the
inhibitory effect on nuclear receptor-stimulated transcription. This
conclusion was supported by the observation that inhibition occurred
when p65 was transfected alone or when p50 and p65 were cotransfected. In addition, the highest dose of the p65 expression vector completely blocked an expected increase in VDRE activity in response to treatment with 1,25(OH)2D3, paralleling TNF-
effects
seen previously. Third, transfection with p50 alone did not alter basal
or hormone-stimulated RXRE reporter activity, and p50 modestly
stimulated VDRE-dependent activity at higher DNA doses. This latter
effect of p50 was unexpected in light of the fact that this subunit has
been described as a DNA-binding protein lacking significant
transactivational capacity and also of having the capacity to bind RXR
and possibly the estrogen receptor (4, 7,
29). Although the mechanism behind this p50 stimulation
remains unclear, it is conceivable that excessive p50 might bind and
sequester endogenous p65, thereby decreasing a tonic p65 inhibition.
Two potential mechanisms whereby NF-
B might block nuclear
receptor-dependent transactivation include direct physical interaction between the NF-
B subunits and the receptors or competitive binding of these NF-
B subunits to a hormone responsive element with
subsequent displacement of nuclear receptors. These hypotheses were
tested by incubating individual NF-
B subunits with a VDRE probe in
either the presence or absence of VDR and RXR. Neither subunit bound this probe in the absence of receptors, nor was VDR-RXR binding to the
DNA influenced by the presence of NF-
B subunits. Consequently, direct competition of NF-
B with VDR/RXR for binding to DNA does not
explain our previous observation that TNF-
treatment blocks nuclear
receptor binding to DNA. The current results instead support a model in
which p65 interferes with receptor-dependent transactivation primarily
through an indirect mechanism. The lack of detectable protein-protein
interactions observed herein shows that the affinity of RXR binding to
DNA must be much greater than any NF-
B-RXR interaction, if this
occurs at all.
The quenching of hormone-stimulated transcription by p65 is consistent
with a mechanism in which p65 competes for and sequesters an essential
cofactor or activator required for VDR- or RXR-mediated transactivation. Support for this hypothesis comes from a steadily increasing body of recent experimental evidence. In several studies, affinity "pull-down" experiments were employed to show that
transcription factors such as SREBP-1a, Sp1, VP16, and the p65 NF-
B
subunit interact with one or more proteins within a large
activator-recruited cofactor (ARC) complex consisting of multiple
proteins. Similarly, a truncated peptide containing the ligand-binding
domain and
-helical region corresponding to the activation
function-2 of VDR has been shown to account for ligand-dependent
association of VDR with proteins within a large VDR-interacting protein
(DRIP) complex (35). Some DRIPs have been found to be
identical to the independently cloned steroid/thyroid receptor
coactivators p100 (DRIP100/TRAP100) and p205
(PBP/RB18A/TRIP2/TRAP220/DRIP230). Furthermore, equivalent electrophoretic mobilities for the majority of ARC and DRIP proteins suggest that these two complexes are essentially the same. This large
complex may bridge DNA-bound transcription factors to the RNA
polymerase II preinitiation complex. VDR and p65 both form associations
with proteins within these complexes and may compete for common factors
that confer optimum transcriptional potency. This model of competitive
sequestration of cofactors is consistent with other reports showing p65
squelches glucocorticoid-dependent transcription by competing for
limited amounts of the coactivators CBP/p300 and SRC-1
(41). A reciprocal inhibition of p65-mediated transcription by glucocorticoid receptor has also been
demonstrated. Similarly, NF-
B-dependent reporter activity has been
shown to be inhibited by addition of RXR ligands, and both prototypical NF-
B subunits were observed to dose dependently block thyroid hormone-stimulated transcription, perhaps reflecting reciprocal inhibition between NF-
B and RXR (29). The inhibition
caused by p65 in our experiments was not shared by c-Rel, another
member of the Rel family of transcription factors, nor was inhibition apparent in the absence of hormone response elements. These
observations confirm the specificity of p65 as a mediator of TNF-
inhibition of VDR or RXR function and ruled out a nonspecific effect of
p65 on transcription.
Upon binding its receptor, TNF-
is thought to activate several
protein kinase cascades, including those involving extracellular signal-regulated kinase, c-Jun NH2-terminal kinase, and p38
mitogen-activated protein kinase (27). Potential synergy
between these additional TNF-
-dependent signaling pathways and
NF-
B in suppressing VDR and RXR function was examined by
transfecting cells with NF-
B alone or NF-
B followed immediately
by treatment with TNF-
. NF-
B significantly inhibited
1,25(OH)2D3-stimulated VDRE-regulated activity,
and this inhibition was not amplified further by TNF-
exposure. This
finding suggests that TNF-
inhibition of transcription is mediated
by NF-
B.
Previous studies from this laboratory showed that TNF-
reduces
binding of heterodimeric RXR-VDR to a VDRE and RXR homodimer binding to
an RXRE (12, 30). In this study, recombinant
NF-
B subunits failed to block binding of VDR-RXR to a VDRE. Thus
TNF-
-induced nuclear translocation of NF-
B in the absence of
additional signaling events would not appear to account for decreased
binding to hormone response elements. It has been suggested that
phosphorylation of VDR by protein kinase C or casein kinase II may be
important in regulating the activity of this receptor (13,
15). TNF-
is known to cause phosphorylation of the p50
and p65 subunits (24, 43), but it remains
unclear whether changes in VDR and RXR phosphorylation occur in
response to TNF-
stimulation. Such TNF-
-dependent phosphorylation
events could result in a different spectrum of action compared with
that observed after the expression of potentially underphosphorylated
NF-
B subunits in our experimental model.
In conclusion, the p65 subunit of NF-
B appears to be one factor that
mediates TNF-
inhibition of VDR- and RXR-dependent transactivation.
This cross talk between previously considered independent pathways may
represent a complex level of signal interaction that is important in
regulating normal and pathophysiological cell processes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Mary Kurian for technical assistance during this study.
| |
FOOTNOTES |
|---|
This work was supported by a Veterans Affairs (VA) Merit Review Grant, National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant 1RO1 AR-44228-01 to M. S. Nanes, and, in part, by a VA Research Enhancement Award.
Address for reprint requests and other correspondence: P. Farmer, Veterans Administration Research Service (151), Rm. 5A169, 1670 Clairmont Rd., Decatur, GA 30033 (E-mail: pfarmer{at}emory.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Received 5 October 1999; accepted in final form 1 February 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ammann, P,
Rizzoli R,
Bonjour JP,
Bourrin S,
Meyer JM,
Vassalli P,
and
Garcia I.
Transgenic mice expressing soluble tumor necrosis factor-receptor are protected against bone loss caused by estrogen deficiency.
J Clin Invest
99:
1699-703,
1997[ISI][Medline].
2.
Andrews, NC,
and
Faller DV.
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells (Abstract).
Nucleic Acids Res
19:
2499,
1991
3.
Aoudjit, F,
Brochu N,
Belanger B,
Stratowa C,
Hiscott J,
and
Audette M.
Regulation of intercellular adhesion molecule-1 gene by tumor necrosis factor-alpha is mediated by the nuclear factor-kappaB heterodimers p65/p65 and p65/c-Rel in the absence of p50.
Cell Growth Differ
8:
335-342,
1997[Abstract].
4.
Baeuerle, PA.
The inducible transcription activator NF-kappa B: regulation by distinct protein subunits.
Biochim Biophys Acta
1072:
63-80,
1991[Medline].
5.
Baeuerle, PA,
and
Baltimore D.
NF-kappa B: ten years after.
Cell
87:
13-20,
1996[ISI][Medline].
6.
Barbeau, B,
Bernier R,
Dumais N,
Briand G,
Olivier M,
Faure R,
Posner BI,
and
Tremblay M.
Activation of HIV-1 long terminal repeat transcription and virus replication via NF-kappaB-dependent and -independent pathways by potent phosphotyrosine phosphatase inhibitors, the peroxovanadium compounds.
J Biol Chem
272:
12968-12977,
1997
7.
Bodine, PV,
Harris HA,
and
Komm BS.
Suppression of ligand-dependent estrogen receptor activity by bone-resorbing cytokines in human osteoblasts.
Endocrinology
140:
2439-2451,
1999
8.
Chen, CC,
and
Manning AM.
Transcriptional regulation of endothelial cell adhesion molecules: a dominant role for NF-kappa B.
Agents Actions Suppl
47:
135-141,
1995[Medline].
9.
Demay, MB,
Gerardi JM,
DeLuca HF,
and
Kronenberg HM.
DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25-dihydroxyvitamin D3.
Proc Natl Acad Sci USA
87:
369-373,
1990
10.
DiDonato, JA,
Hayakawa M,
Rothwarf DM,
Zandi E,
and
Karin M.
A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB.
Nature
388:
548-554,
1997[Medline].
11.
Faure, E,
Lecine P,
Imbert J,
and
Champion S.
Activation of the HIV type 1 long terminal repeat by X-irradiation involves two main Re1/NF-kappa B DNA-binding complexes.
AIDS Res Hum Retroviruses
12:
1519-1527,
1996[ISI][Medline].
12.
Fernandez-Martin, JL,
Kurian S,
Farmer P,
and
Nanes MS.
Tumor necrosis factor activates a nuclear inhibitor of vitamin D and retinoid-X receptors.
Mol Cell Endocrinol
141:
65-72,
1998[ISI][Medline].
13.
Hsieh, JC,
Jurutka PW,
Galligan MA,
Terpening CM,
Haussler CA,
Samuels DS,
Shimizu Y,
Shimizu N,
and
Haussler MR.
Human vitamin D receptor is selectively phosphorylated by protein kinase C on serine 51, a residue crucial to its trans-activation function.
Proc Natl Acad Sci USA
88:
9315-9319,
1991
14.
Israel, N,
Gougerot-Pocidalo MA,
Aillet F,
and
Virelizier JL.
Redox status of cells influences constitutive or induced NF-kappa B translocation and HIV long terminal repeat activity in human T and monocytic cell lines.
J Immunol
149:
3386-3393,
1992[Abstract].
15.
Jurutka, PW,
Hsieh JC,
MacDonald PN,
Terpening CM,
Haussler CA,
Haussler MR,
and
Whitfield GK.
Phosphorylation of serine 208 in the human vitamin D receptor. The predominant amino acid phosphorylated by casein kinase II, in vitro, and identification as a significant phosphorylation site in intact cells.
J Biol Chem
268:
6791-6799,
1993
16.
Kieran, M,
Blank V,
Logeat F,
Vandekerckhove J,
Lottspeich F,
Le Bail O,
Urban MB,
Kourilsky P,
Baeuerle PA,
and
Israel A.
The DNA binding subunit of NF-kappa B is identical to factor KBF1 and homologous to the rel oncogene product.
Cell
62:
1007-1018,
1990[ISI][Medline].
17.
Kimble, RB,
Matayoshi AB,
Vannice JL,
Kung VT,
Williams C,
and
Pacifici R.
Simultaneous block of interleukin-1 and tumor necrosis factor is required to completely prevent bone loss in the early postovariectomy period.
Endocrinology
136:
3054-3061,
1995[Abstract].
18.
Kinyamu, HK,
Gallagher JC,
Balhorn KE,
Petranick KM,
and
Rafferty KA.
Serum vitamin D metabolites and calcium absorption in normal young and elderly free-living women and in women living in nursing homes.
Am J Clin Nutr
65:
790-797,
1997
19.
Kitazawa, R,
Kimble RB,
Vannice JL,
Kung VT,
and
Pacifici R.
Interleukin-1 receptor antagonist and tumor necrosis factor binding protein decrease osteoclast formation and bone resorption in ovariectomized mice.
J Clin Invest
94:
2397-2406,
1994.
20.
Kuno, H,
Kurian SM,
Hendy GN,
White J,
deLuca HF,
Evans CO,
and
Nanes MS.
Inhibition of 1,25-dihydroxyvitamin D3 stimulated osteocalcin gene transcription by tumor necrosis factor-alpha: structural determinants within the vitamin D response element.
Endocrinology
134:
2524-2531,
1994[Abstract].
21.
Kunsch, C,
Lang RK,
Rosen CA,
and
Shannon MF.
Synergistic transcriptional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF-IL-6.
J Immunol
153:
153-164,
1994[Abstract].
22.
Lader, CS,
and
Flanagan AM.
Prostaglandin E2, interleukin 1alpha, and tumor necrosis factor-alpha increase human osteoclast formation and bone resorption in vitro.
Endocrinology
139:
3157-3164,
1998
23.
Lapointe, R,
Lemieux R,
and
Darveau A.
HIV-1 LTR activity in human CD40-activated B lymphocytes is dependent on NF-kappaB.
Biochem Biophys Res Commun
229:
959-964,
1996[ISI][Medline].
24.
Li, CC,
Dai RM,
Chen E,
and
Longo DL.
Phosphorylation of NF-KB1-p50 is involved in NF-kappa B activation and stable DNA binding.
J Biol Chem
269:
30089-30092,
1994
25.
Malinin, NL,
Boldin MP,
Kovalenko AV,
and
Wallach D.
MAP3K-related kinase involved in NF-kappaB induction by TNF, CD95 and IL-1.
Nature
385:
540-544,
1997[Medline].
26.
Mayur, N,
Lewis S,
Catherwood BD,
and
Nanes MS.
Tumor necrosis factor alpha decreases 1,25-dihydroxyvitamin D3 receptors in osteoblastic ROS 17/2.8 cells.
J Bone Miner Res
8:
997-1003,
1993[ISI][Medline].
27.
McLeish, KR,
Knall C,
Ward RA,
Gerwins P,
Coxon PY,
Klein JB,
and
Johnson GL.
Activation of mitogen-activated protein kinase cascades during priming of human neutrophils by TNF-alpha and GM-CSF.
J Leukoc Biol
64:
537-545,
1998[Abstract].
28.
Mercurio, F,
Zhu H,
Murray BW,
Shevchenko A,
Bennett BL,
Li J,
Young DB,
Barbosa M,
Mann M,
Manning A,
and
Rao A.
IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation.
Science
278:
860-866,
1997
29.
Na, SY,
Kang BY,
Chung SW,
Han SJ,
Ma X,
Trinchieri G,
Im SY,
Lee JW,
and
Kim TS.
Retinoids inhibit interleukin-12 production in macrophages through physical associations of retinoid X receptor and NFkappaB.
J Biol Chem
274:
7674-7680,
1999
30.
Nanes, MS,
Kuno H,
Demay MB,
Kurian M,
Hendy GN,
DeLuca HF,
Titus L,
and
Rubin J.
A single up-stream element confers responsiveness to 1,25-dihydroxyvitamin D3 and tumor necrosis factor-alpha in the rat osteocalcin gene.
Endocrinology
134:
1113-1120,
1994[Abstract].
31.
Nanes, MS,
Rubin J,
Titus L,
Hendy GN,
and
Catherwood B.
Tumor necrosis factor-alpha inhibits 1,25-dihydroxyvitamin D3-stimulated bone Gla protein synthesis in rat osteosarcoma cells (ROS 17/2.8) by a pretranslational mechanism.
Endocrinology
128:
2577-2582,
1991[Abstract].
32.
Need, AG,
Morris HA,
Horowitz M,
and
Nordin BE.
The response to calcitriol therapy in postmenopausal osteoporotic women is a function of initial calcium absorptive status.
Calcif Tissue Int
61:
6-9,
1997[ISI][Medline].
33.
Need, AG,
Morris HA,
Horowitz M,
Scopacasa E,
and
Nordin BE.
Intestinal calcium absorption in men with spinal osteoporosis.
Clin Endocrinol (Oxf)
48:
163-168,
1998[Medline].
34.
Nolan, GP,
Ghosh S,
Liou HC,
Tempst P,
and
Baltimore D.
DNA binding and I kappa B inhibition of the cloned p65 subunit of NF-kappa B, a rel-related polypeptide.
Cell
64:
961-969,
1991[ISI][Medline].
35.
Rachez, C,
Lemon BD,
Suldan Z,
Bromleigh V,
Gamble M,
Naar AM,
Erdjument-Bromage H,
Tempst P,
and
Freedman LP.
Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex.
Nature
398:
824-828,
1999[Medline].
36.
Ray, A,
and
Ray BK.
Lipopolysaccharide-mediated induction of the bovine interleukin-6 gene in monocytes requires both NF-kappa B and C/EBP binding sites.
DNA Cell Biol
14:
795-802,
1995[ISI][Medline].
37.
Schafer, SL,
Hiscott J,
and
Pitha PM.
Differential regulation of the HIV-1 LTR by specific NF-kappa B subunits in HSV-1-infected cells.
Virology
224:
214-223,
1996[ISI][Medline].
38.
Schmitz, ML,
and
Baeuerle PA.
The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B.
EMBO J
10:
3805-3817,
1991[ISI][Medline].
39.
Schmitz, ML,
dos Santos Silva MA,
and
Baeuerle PA.
Transactivation domain 2 (TA2) of p65 NF-kappa B Similarity to TA1 and phorbol ester-stimulated activity and phosphorylation in intact cells.
J Biol Chem
270:
15576-15584,
1995
40.
Seed, B,
and
Sheen JY.
A simple phase-extraction assay for chloramphenicol acyltransferase activity.
Gene
67:
271-277,
1988[ISI][Medline].
41.
Sheppard, KA,
Phelps KM,
Williams AJ,
Thanos D,
Glass CK,
Rosenfeld MG,
Gerritsen ME,
and
Collins T.
Nuclear integration of glucocorticoid receptor and nuclear factor- kappaB signaling by CREB-binding protein and steroid receptor coactivator-1.
J Biol Chem
273:
29291-29294,
1998
42.
Verweij, CL,
Geerts M,
and
Aarden LA.
Activation of interleukin-2 gene transcription via the T-cell surface molecule CD28 is mediated through an NF-kB-like response element.
J Biol Chem
266:
14179-14182,
1991
43.
Wang, D,
and
Baldwin AS, Jr.
Activation of nuclear factor-kappaB-dependent transcription by tumor necrosis factor-alpha is mediated through phosphorylation of RelA/p65 on serine 529.
J Biol Chem
273:
29411-29416,
1998
This article has been cited by other articles:
![]() |
K. Silbermann, G. Schneider, and R. Grassmann Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-{kappa}B and NFAT J. Gen. Virol., November 1, 2008; 89(11): 2788 - 2798. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gilbert, X. He, P. Farmer, J. Rubin, H. Drissi, A. J. van Wijnen, J. B. Lian, G. S. Stein, and M. S. Nanes Expression of the Osteoblast Differentiation Factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) Is Inhibited by Tumor Necrosis Factor-alpha J. Biol. Chem., January 18, 2002; 277(4): 2695 - 2701. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK |